Review



mouse anti adar1  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Santa Cruz Biotechnology mouse anti adar1
    Mouse Anti Adar1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+adar1/ADAR1+Antibody/pmc12951995-69-6-9
    Average 95 stars, based on 207 article reviews
    mouse anti adar1 - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    other:

    Article Title: Unbiased Identification of trans Regulators of ADAR and A-to-I RNA Editing
    Article Snippet: Mouse anti-ADAR1 , Santa Cruz ADAR1 , Catsc-73408; RRID:AB_2222767.

    Real-time Polymerase Chain Reaction:

    Article Title: Adenosine deaminase acting on RNA-1 (ADAR1) inhibits hepatitis B virus (HBV) replication by enhancing microRNA-122 processing
    Article Snippet: .. Rabbit anti-GAPDH (Proteintech Group, Rosemont, IL), mouse anti-FLAG (Medical and Biological Laboratories Co., Ltd., Aichi, Japan), anti-core (Dako; B0586), rabbit anti-GFP (Santa Cruz Biotechnology, Dallas, TX), anti-rabbit IgG (LI-COR, Lincoln, NE), rabbit anti-cyclin G1 (Abclonal, Woburn, MA), anti-mouse IgG (LI-COR, Lincoln, NE), rabbit anti-p53 (Abclonal), and mouse anti-ADAR1 (Santa Cruz Biotechnology) antibodies were used and the density of ADAR1 was measured using ImageJ software. qPCR and RT-PCR Total RNA was extracted using TRIsure (Thermo Fisher Scientific), treated with DNase I (TakaRa Bio) to eliminate the transfected plasmids, and reverse-transcribed with an oligo(dT) or specific primer using Superscript II (Thermo Fisher Scientific). qPCR was performed using SYBR Green ROX (TaKaRa Bio) and qTower2.2 (Analytik Jena, Jena, Germany). ..

    Article Title: ADAR1 haploinsufficiency and sustained picornaviral RdRp dsRNA synthesis synergize to dysregulate RNA editing and cause multi-system interferonopathy
    Article Snippet: .. a. Primers Mus musculus Gapdh: 5’-CATGGCCTTCCGTGTTCCTA-3’ & 5’-CTATGTTTCCCGCGGCACGTCAGATCCA-3’ Ifit1: 5’-TTTGTTGTTGTTGTTGTTCGTT-3’ & 5’-GCAGGAATCAGTTGTGATCT-3’ ISG15: 5’- TGGTACAGAACTGCAGCGAG -3’ & 5’- CAGCCAGAACTGGTCTTCGT -3’ Oasl2: 5’-CAAACAAACAAACAAACCCTCTC-3’ & 5’-TCAAGGTGTCACTCTGCAT-3’ Adar p150 5’-GGCCTTGCCGGCACTATGTCTC-3’ & 5’ GCGGGTATCTCCACTTGCTATGCTC3’ Adar p110: 5’-GGTGGAAGACTACGCGTTGGGAC-3’ & 5’ ACGACTGTGTCTGGTGAGGGAACAC-3’ IFNβ: 5’-CACAGCCCTCTCCATCAACTATAAGCAG-3’& 5’- CTGTAGGTGAGGTTGATCTTTCCATTCAG-3’ Homo sapiens GAPDH: 5’-TGGACCTGACCTGCCGT-3’ & 5’-TGGAGGAGTGGGTGTCGC-3’ ISG15: 5’-GTGGACAAATGCGACGAACC-3’ & 5’-ATTTCCGGCCCTTGATCCTG-3’ OASL: 5’-GGATCTTCTCCCACACTCACATCT-3’ & 5’-CACCATCAGGATTCTTCACGAA-3’ b. Antibodies Rabbit polyclonal anti-ADAR1 (1:1,000 dilution; Cell Signaling, 14175) Mouse anti-tubulin (1:5,000 dilution; Sigma, T5168) Rabbit anti-Rig-I: mouse tissue blots (1:1,000 dilution, Cell Signaling, 3743) Mouse anti-ADAR1 (1:500 dilution, Santa Cruz Bio, sc-73408) Rabbit anti-actin (1:5,000 dilution, Cell Signaling, 4967) Goat anti-rabbit secondary antibody, horseradish peroxidase -conjugated (1:5,000 dilution; Calbiochem, 401393) Goat anti-mouse secondary antibody horseradish peroxidase-conjugated (1:5,000 dilution; Invitrogen, 31430) Rabbit anti-ZBP1/DAI (1:1,000 dilution; Novus Biologicals NBP1-76854) Rabbit anti-ISG15 (1:1000, Cell Signaling Technologies Cat # 2743) Quantitative PCR. .. For qPCR analysis of mouse samples, RNA was extracted from mouse tissue using Trizol reagent (Ambion) according to manufacturer instructions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Adenosine deaminase acting on RNA-1 (ADAR1) inhibits hepatitis B virus (HBV) replication by enhancing microRNA-122 processing
    Article Snippet: .. Rabbit anti-GAPDH (Proteintech Group, Rosemont, IL), mouse anti-FLAG (Medical and Biological Laboratories Co., Ltd., Aichi, Japan), anti-core (Dako; B0586), rabbit anti-GFP (Santa Cruz Biotechnology, Dallas, TX), anti-rabbit IgG (LI-COR, Lincoln, NE), rabbit anti-cyclin G1 (Abclonal, Woburn, MA), anti-mouse IgG (LI-COR, Lincoln, NE), rabbit anti-p53 (Abclonal), and mouse anti-ADAR1 (Santa Cruz Biotechnology) antibodies were used and the density of ADAR1 was measured using ImageJ software. qPCR and RT-PCR Total RNA was extracted using TRIsure (Thermo Fisher Scientific), treated with DNase I (TakaRa Bio) to eliminate the transfected plasmids, and reverse-transcribed with an oligo(dT) or specific primer using Superscript II (Thermo Fisher Scientific). qPCR was performed using SYBR Green ROX (TaKaRa Bio) and qTower2.2 (Analytik Jena, Jena, Germany). ..

    Transfection:

    Article Title: Adenosine deaminase acting on RNA-1 (ADAR1) inhibits hepatitis B virus (HBV) replication by enhancing microRNA-122 processing
    Article Snippet: .. Rabbit anti-GAPDH (Proteintech Group, Rosemont, IL), mouse anti-FLAG (Medical and Biological Laboratories Co., Ltd., Aichi, Japan), anti-core (Dako; B0586), rabbit anti-GFP (Santa Cruz Biotechnology, Dallas, TX), anti-rabbit IgG (LI-COR, Lincoln, NE), rabbit anti-cyclin G1 (Abclonal, Woburn, MA), anti-mouse IgG (LI-COR, Lincoln, NE), rabbit anti-p53 (Abclonal), and mouse anti-ADAR1 (Santa Cruz Biotechnology) antibodies were used and the density of ADAR1 was measured using ImageJ software. qPCR and RT-PCR Total RNA was extracted using TRIsure (Thermo Fisher Scientific), treated with DNase I (TakaRa Bio) to eliminate the transfected plasmids, and reverse-transcribed with an oligo(dT) or specific primer using Superscript II (Thermo Fisher Scientific). qPCR was performed using SYBR Green ROX (TaKaRa Bio) and qTower2.2 (Analytik Jena, Jena, Germany). ..

    Reverse Transcription:

    Article Title: Adenosine deaminase acting on RNA-1 (ADAR1) inhibits hepatitis B virus (HBV) replication by enhancing microRNA-122 processing
    Article Snippet: .. Rabbit anti-GAPDH (Proteintech Group, Rosemont, IL), mouse anti-FLAG (Medical and Biological Laboratories Co., Ltd., Aichi, Japan), anti-core (Dako; B0586), rabbit anti-GFP (Santa Cruz Biotechnology, Dallas, TX), anti-rabbit IgG (LI-COR, Lincoln, NE), rabbit anti-cyclin G1 (Abclonal, Woburn, MA), anti-mouse IgG (LI-COR, Lincoln, NE), rabbit anti-p53 (Abclonal), and mouse anti-ADAR1 (Santa Cruz Biotechnology) antibodies were used and the density of ADAR1 was measured using ImageJ software. qPCR and RT-PCR Total RNA was extracted using TRIsure (Thermo Fisher Scientific), treated with DNase I (TakaRa Bio) to eliminate the transfected plasmids, and reverse-transcribed with an oligo(dT) or specific primer using Superscript II (Thermo Fisher Scientific). qPCR was performed using SYBR Green ROX (TaKaRa Bio) and qTower2.2 (Analytik Jena, Jena, Germany). ..

    SYBR Green Assay:

    Article Title: Adenosine deaminase acting on RNA-1 (ADAR1) inhibits hepatitis B virus (HBV) replication by enhancing microRNA-122 processing
    Article Snippet: .. Rabbit anti-GAPDH (Proteintech Group, Rosemont, IL), mouse anti-FLAG (Medical and Biological Laboratories Co., Ltd., Aichi, Japan), anti-core (Dako; B0586), rabbit anti-GFP (Santa Cruz Biotechnology, Dallas, TX), anti-rabbit IgG (LI-COR, Lincoln, NE), rabbit anti-cyclin G1 (Abclonal, Woburn, MA), anti-mouse IgG (LI-COR, Lincoln, NE), rabbit anti-p53 (Abclonal), and mouse anti-ADAR1 (Santa Cruz Biotechnology) antibodies were used and the density of ADAR1 was measured using ImageJ software. qPCR and RT-PCR Total RNA was extracted using TRIsure (Thermo Fisher Scientific), treated with DNase I (TakaRa Bio) to eliminate the transfected plasmids, and reverse-transcribed with an oligo(dT) or specific primer using Superscript II (Thermo Fisher Scientific). qPCR was performed using SYBR Green ROX (TaKaRa Bio) and qTower2.2 (Analytik Jena, Jena, Germany). ..



    Similar Products

    mouse anti adar1  (Santa Cruz Biotechnology)
    95
    Santa Cruz Biotechnology mouse anti adar1
    Mouse Anti Adar1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+adar1/ADAR1+Antibody/pmc12951995-69-6-9
    Average 95 stars, based on 1 article reviews
    mouse anti adar1 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    mouse monoclonal anti adar1  (Santa Cruz Biotechnology)
    95
    Santa Cruz Biotechnology mouse monoclonal anti adar1
    Mouse Monoclonal Anti Adar1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+adar1/ADAR1+Antibody/pmc12780141-722-73-76
    Average 95 stars, based on 1 article reviews
    mouse monoclonal anti adar1 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    mouse mab sc 271854  (Santa Cruz Biotechnology)
    95
    Santa Cruz Biotechnology mouse mab sc 271854
    Mouse Mab Sc 271854, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+adar1/ADAR1+Antibody/pmc12288899-182-5-10
    Average 95 stars, based on 1 article reviews
    mouse mab sc 271854 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    mouse anti adar1 monoclonal antibody  (Santa Cruz Biotechnology)
    95
    Santa Cruz Biotechnology mouse anti adar1 monoclonal antibody
    Mouse Anti Adar1 Monoclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+adar1/ADAR1+Antibody/pm40010639-50-16-22
    Average 95 stars, based on 1 article reviews
    mouse anti adar1 monoclonal antibody - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    mouse neun 147  (Proteintech)
    94
    Proteintech mouse neun 147
    Mouse Neun 147, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+adar1/ADAR1+Antibody/10__1523_slash_jneurosci__1265___24__2024-48-48-56
    Average 94 stars, based on 1 article reviews
    mouse neun 147 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results